Bpgm Binding Assay

Lab Reagents

Binding Assay Laboratories manufactures the bpgm binding assay reagents distributed by Genprice. The Bpgm Binding Assay reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact binding assay. Other Bpgm products are available in stock. Specificity: Bpgm Category: Binding Group: Assay

Assay information

Retinol Binding Protein Assay Kit

abx098452-Hitachi7170R130ml2R220ml1 Hitachi 7170; R1 30ml×2 R2 20ml×1
EUR 504
  • Shipped within 5-12 working days.

Retinol Binding Protein Assay Kit

abx098452-Hitachi7170R160ml1R220ml1 Hitachi 7170; R1 60ml×1 R2 20ml×1
EUR 504
  • Shipped within 5-12 working days.

BPGM Blocking Peptide

33R-2684 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of BPGM antibody, catalog no. 70R-2888

BPGM Blocking Peptide

33R-5292 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of BPGM antibody, catalog no. 70R-2929

Human BPGM Antibody

33147-05111 150 ug
EUR 261

BPGM Conjugated Antibody

C46351 100ul
EUR 397

BPGM cloning plasmid

CSB-CL002781HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 780
  • Sequence: atgtccaagtacaaacttattatgttaagacatggagagggtgcttggaataaggagaaccgtttttgtagctgggtggatcagaaactcaacagcgaaggaatggaggaagctcggaactgtgggaagcaactcaaagcgttaaactttgagtttgatcttgtattcacatctgt
  • Show more
Description: A cloning plasmid for the BPGM gene.

BPGM Rabbit pAb

A7880-100ul 100 ul
EUR 308

BPGM Rabbit pAb

A7880-200ul 200 ul
EUR 459

BPGM Rabbit pAb

A7880-20ul 20 ul
EUR 183

BPGM Rabbit pAb

A7880-50ul 50 ul
EUR 223

anti- BPGM antibody

FNab00934 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: 2, 3-bisphosphoglycerate mutase
  • Uniprot ID: P07738
  • Gene ID: 669
  • Research Area: Cardiovascular, Metabolism
Description: Antibody raised against BPGM

Anti-BPGM antibody

PAab00934 100 ug
EUR 355

pCMV-SPORT6-BPGM

PVT13458 2 ug
EUR 391

Anti-BPGM antibody

STJ110190 100 µl
EUR 277
Description: 2,3-diphosphoglycerate (2,3-DPG) is a small molecule found at high concentrations in red blood cells where it binds to and decreases the oxygen affinity of hemoglobin. This gene encodes a multifunctional enzyme that catalyzes 2,3-DPG synthesis via its synthetase activity, and 2,3-DPG degradation via its phosphatase activity. The enzyme also has phosphoglycerate phosphomutase activity. Deficiency of this enzyme increases the affinity of cells for oxygen. Mutations in this gene result in hemolytic anemia. Multiple alternatively spliced variants, encoding the same protein, have been identified.

Human Bisphosphoglycerate mutase (BPGM)

1-CSB-EP002781HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 56.9 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Bisphosphoglycerate mutase(BPGM) expressed in E.coli

BPGM protein (His tag)

80R-1292 100 ug
EUR 268
Description: Purified recombinant Human BPGM protein