Cfh Binding Assay

Lab Reagents

Binding Assay Laboratories manufactures the cfh binding assay reagents distributed by Genprice. The Cfh Binding Assay reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact binding assay. Other Cfh products are available in stock. Specificity: Cfh Category: Binding Group: Assay

Assay information

Mouse Complement Factor H (CFH) ELISA Kit

RDR-CFH-Mu-96Tests 96 Tests
EUR 709

CFH/ Rat CFH ELISA Kit

ELA-E0635r 96 Tests
EUR 886

Retinol Binding Protein Assay Kit

abx098452-Hitachi7060R130ml2R220ml1 Hitachi 7060; R1 30ml×2 R2 20ml×1
EUR 504
  • Shipped within 5-12 working days.

Retinol Binding Protein Assay Kit

abx098452-Hitachi7170R130ml2R220ml1 Hitachi 7170; R1 30ml×2 R2 20ml×1
EUR 504
  • Shipped within 5-12 working days.

Retinol Binding Protein Assay Kit

abx098452-Hitachi7170R160ml1R220ml1 Hitachi 7170; R1 60ml×1 R2 20ml×1
EUR 504
  • Shipped within 5-12 working days.

CFH siRNA

20-abx911596
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CFH siRNA

20-abx911597
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

CFH Antibody

ABD6889 100 ug
EUR 438

CFH antibody

38390-100ul 100ul
EUR 252

CFH antibody

70R-16368 50 ul
EUR 435
Description: Rabbit polyclonal CFH antibody

CFH Antibody

DF6889 200ul
EUR 304
Description: CFH Antibody detects endogenous levels of total CFH.

CFH Antibody

1-CSB-PA005273ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against CFH. Recognizes CFH from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200

CFH Antibody

1-CSB-PA005273GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against CFH. Recognizes CFH from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB

CFH Conjugated Antibody

C38390 100ul
EUR 397

CFH cloning plasmid

CSB-CL005273HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1350
  • Sequence: atgagacttctagcaaagattatttgccttatgttatgggctatttgtgtagcagaagattgcaatgaacttcctccaagaagaaatacagaaattctgacaggttcctggtctgaccaaacatatccagaaggcacccaggctatctataaatgccgccctggatatagatctc
  • Show more
Description: A cloning plasmid for the CFH gene.

CFH Rabbit pAb

A1360-100ul 100 ul
EUR 308

CFH Rabbit pAb

A1360-200ul 200 ul
EUR 459